Review



resource source identifier antibodies anti mouse il 1b r d systems cat  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    R&D Systems resource source identifier antibodies anti mouse il 1b r d systems cat
    Figure 1. Identification of ENB as a potent inhibitor of the NLRP3 inflammasome (A–C) ELISA analysis of <t>IL-1b</t> in culture supernatants (SNs) from LPS-primed BMDMs treated with various doses of ENB and then stimulated with 150 mg/mL MSU for 4 h (A), 5 mM nigericin (B), or 2.5 mM ATP (C) for 30 min. (D) Immunoblot analysis of IL-1b and cleaved caspase-1 (P20) in SN, pro-IL-1b and pro-caspase-1 (Pro-casp1) in cell lysates (input) from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (E) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (F) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (G) ELISA of IL-1b in SN from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (H) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. (I) ELISA of IL-1b in SNs from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. Data represent the mean ± SEM of three (A–C and E) or four (G and I) technical replicates from one of five independent experiments. Statistical analysis was performed using one-way ANOVA (G and I) or two-way ANOVA (E). *p < 0.05, **p < 0.01, ***p < 0.001.
    Resource Source Identifier Antibodies Anti Mouse Il 1b R D Systems Cat, supplied by R&D Systems, used in various techniques. Bioz Stars score: 98/100, based on 988 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+anti+mouse+il+1b+r+d+systems+cat/Mouse+IL-1+beta%2FIL-1F2+Antibody/pm38118409-163-2-8
    Average 98 stars, based on 988 article reviews
    resource source identifier antibodies anti mouse il 1b r d systems cat - by Bioz Stars, 2026-10
    98/100 stars

    Images

    1) Product Images from "Entrectinib inhibits NLRP3 inflammasome and inflammatory diseases by directly targeting NEK7."

    Article Title: Entrectinib inhibits NLRP3 inflammasome and inflammatory diseases by directly targeting NEK7.

    Journal: Cell reports. Medicine

    doi: 10.1016/j.xcrm.2023.101310

    Figure 1. Identification of ENB as a potent inhibitor of the NLRP3 inflammasome (A–C) ELISA analysis of IL-1b in culture supernatants (SNs) from LPS-primed BMDMs treated with various doses of ENB and then stimulated with 150 mg/mL MSU for 4 h (A), 5 mM nigericin (B), or 2.5 mM ATP (C) for 30 min. (D) Immunoblot analysis of IL-1b and cleaved caspase-1 (P20) in SN, pro-IL-1b and pro-caspase-1 (Pro-casp1) in cell lysates (input) from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (E) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (F) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (G) ELISA of IL-1b in SN from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (H) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. (I) ELISA of IL-1b in SNs from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. Data represent the mean ± SEM of three (A–C and E) or four (G and I) technical replicates from one of five independent experiments. Statistical analysis was performed using one-way ANOVA (G and I) or two-way ANOVA (E). *p < 0.05, **p < 0.01, ***p < 0.001.
    Figure Legend Snippet: Figure 1. Identification of ENB as a potent inhibitor of the NLRP3 inflammasome (A–C) ELISA analysis of IL-1b in culture supernatants (SNs) from LPS-primed BMDMs treated with various doses of ENB and then stimulated with 150 mg/mL MSU for 4 h (A), 5 mM nigericin (B), or 2.5 mM ATP (C) for 30 min. (D) Immunoblot analysis of IL-1b and cleaved caspase-1 (P20) in SN, pro-IL-1b and pro-caspase-1 (Pro-casp1) in cell lysates (input) from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (E) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (F) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (G) ELISA of IL-1b in SN from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (H) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. (I) ELISA of IL-1b in SNs from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. Data represent the mean ± SEM of three (A–C and E) or four (G and I) technical replicates from one of five independent experiments. Statistical analysis was performed using one-way ANOVA (G and I) or two-way ANOVA (E). *p < 0.05, **p < 0.01, ***p < 0.001.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Western Blot, Transfection

    Figure 2. ENB specifically inhibits NLRP3 without affecting activation of other inflammasomes (A) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or transfected with 0.5 mg/mL poly(dA:dT) for 4 h. (B) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or transfected with 0.5 mg/mL poly(dA:dT) for 4 h. (C) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and Pro-casp1 in input from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or infected with Salmonella (multiplicity of infection [MOI] = 5) for 4 h. (D) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or infected with Salmonella (MOI = 5) for 4 h. (E) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or 0.5 mg/mL C. difficile toxin B (TcdB) for 1 h or infected with L. monocytogenes (Listeria; MOI = 10) for 4 h. (F) ELISA of IL-1b in SNs from phorbol 12-myristate 13-acetate (PMA)-differentiated and LPS-primed THP-1 cells treated with 2 mM ENB and then stimulated with 5 mM nigericin for 1 h or 10 mM Val-boroPro (VbP) for 24 h. (G) Immunoblot analysis of NLRP3 and pro-IL-1b in input from BMDMs treated with various doses of ENB and then stimulated with 50 ng/mL LPS for 3 h. (H and I) ELISA of TNF-a (H) and IL-6 (I) in SNs from BMDMs treated with various doses of ENB and then stimulated with 50 ng/mL LPS for 3 h. Data represent the mean ± SEM of four technical replicates from one of five independent experiments. Statistical analysis was performed using two-way ANOVA (B and D–F). ***p < 0.001.
    Figure Legend Snippet: Figure 2. ENB specifically inhibits NLRP3 without affecting activation of other inflammasomes (A) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or transfected with 0.5 mg/mL poly(dA:dT) for 4 h. (B) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or transfected with 0.5 mg/mL poly(dA:dT) for 4 h. (C) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and Pro-casp1 in input from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or infected with Salmonella (multiplicity of infection [MOI] = 5) for 4 h. (D) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or infected with Salmonella (MOI = 5) for 4 h. (E) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or 0.5 mg/mL C. difficile toxin B (TcdB) for 1 h or infected with L. monocytogenes (Listeria; MOI = 10) for 4 h. (F) ELISA of IL-1b in SNs from phorbol 12-myristate 13-acetate (PMA)-differentiated and LPS-primed THP-1 cells treated with 2 mM ENB and then stimulated with 5 mM nigericin for 1 h or 10 mM Val-boroPro (VbP) for 24 h. (G) Immunoblot analysis of NLRP3 and pro-IL-1b in input from BMDMs treated with various doses of ENB and then stimulated with 50 ng/mL LPS for 3 h. (H and I) ELISA of TNF-a (H) and IL-6 (I) in SNs from BMDMs treated with various doses of ENB and then stimulated with 50 ng/mL LPS for 3 h. Data represent the mean ± SEM of four technical replicates from one of five independent experiments. Statistical analysis was performed using two-way ANOVA (B and D–F). ***p < 0.001.

    Techniques Used: Activation Assay, Western Blot, Transfection, Enzyme-linked Immunosorbent Assay, Infection

    Figure 3. ENB suppresses NLRP3 inflammasome assembly by directly targeting NEK7 (A) Immunoblot analysis of ASC oligomerization in cross-linked cytosolic pellets of LPS-primed BMDMs treated with various doses of ENB and then stimulated with 5 mM nigericin for 30 min. (B and C) Immunoprecipitation (IP) and immunoblot analysis of the interaction between endogenous ASC (B) or NEK7 (C) and NLRP3 in LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min. (D) IP and immunoblot analysis of HEK293T cells transfected with VSV-NLRP3, FLAG-NEK7, or empty vector plasmids as indicated and treated with 2 mM ENB or 1 mM MCC950. (E) Drug affinity responsive target stability (DARTS) and immunoblot analysis of NEK7, NLRP3, ASC, and pro-casp1 in LPS-primed BMDMs treated with 200 mM ENB and then performed with pronase (25 ng/mg of protein). (F) DARTS and immunoblot analysis of NEK7 in HEK293T cells transfected with GFP-NEK7 and then treated with 200 mM ENB and pronase (25 ng/mg of protein). (G) Cellular thermal shift assays (CETSAs) and immunoblot analysis of NEK7 stability in LPS-primed BMDMs treated with 200 mM ENB at different temperatures. (H) Immunoblot analysis of IL-1b and P20 in SNs, pro-IL-1b, and pro-casp1 in input from pam3CSK4-primed human BLaER1 monocytes treated with various doses of ENB and then stimulated with 5 mM nigericin for 2 h. (I) ELISA of IL-1b in SNs from pam3CSK4-primed human BLaER1 monocytes treated with various doses of ENB and then stimulated with 5 mM nigericin for 2 h. Data represent the mean ± SEM of four technical replicates from one of five independent experiments (I).
    Figure Legend Snippet: Figure 3. ENB suppresses NLRP3 inflammasome assembly by directly targeting NEK7 (A) Immunoblot analysis of ASC oligomerization in cross-linked cytosolic pellets of LPS-primed BMDMs treated with various doses of ENB and then stimulated with 5 mM nigericin for 30 min. (B and C) Immunoprecipitation (IP) and immunoblot analysis of the interaction between endogenous ASC (B) or NEK7 (C) and NLRP3 in LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min. (D) IP and immunoblot analysis of HEK293T cells transfected with VSV-NLRP3, FLAG-NEK7, or empty vector plasmids as indicated and treated with 2 mM ENB or 1 mM MCC950. (E) Drug affinity responsive target stability (DARTS) and immunoblot analysis of NEK7, NLRP3, ASC, and pro-casp1 in LPS-primed BMDMs treated with 200 mM ENB and then performed with pronase (25 ng/mg of protein). (F) DARTS and immunoblot analysis of NEK7 in HEK293T cells transfected with GFP-NEK7 and then treated with 200 mM ENB and pronase (25 ng/mg of protein). (G) Cellular thermal shift assays (CETSAs) and immunoblot analysis of NEK7 stability in LPS-primed BMDMs treated with 200 mM ENB at different temperatures. (H) Immunoblot analysis of IL-1b and P20 in SNs, pro-IL-1b, and pro-casp1 in input from pam3CSK4-primed human BLaER1 monocytes treated with various doses of ENB and then stimulated with 5 mM nigericin for 2 h. (I) ELISA of IL-1b in SNs from pam3CSK4-primed human BLaER1 monocytes treated with various doses of ENB and then stimulated with 5 mM nigericin for 2 h. Data represent the mean ± SEM of four technical replicates from one of five independent experiments (I).

    Techniques Used: Western Blot, Immunoprecipitation, Transfection, Plasmid Preparation, Enzyme-linked Immunosorbent Assay

    Figure 4. ENB binds to R121 of NEK7 (A) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with various doses of ENB for 15 min and then washed three times and stimulated with 5 mM nigericin for 30 min. (B) Docking complex of NEK7 with ENB. ENB is shown as sticks and colored light green, NEK7 is showed in cartoon and colored light gray, and key amino acid residues are shown as sticks. (C) 2D binding mode diagrams of NEK7 and ENB. (D) DARTS and immunoblot analysis of NEK7 in HEK293T cells transfected with WT, I40A, or R121A mutant FLAG-NEK7 and then treated with 200 mM ENB and pronase (25 ng/mg of protein). (E) IP and immunoblot analysis of HEK293T cells transfected with VSV-NLRP3, WT, or R121A mutant FLAG-NEK7 plasmids as indicated and treated with 2 mM ENB. (F) ELISA analysis of IL-1b in SNs from NEK7 knockout THP-1 cells recombined with human WT or R121A mutant NEK7 and then stimulated with 5 mM nigericin for 1 h. (G) ELISA of IL-1b in SNs from NEK7 knockout iBMDMs recombined with mouse WT or R121A mutant NEK7 and then stimulated with 5 mM nigericin for 2 h. (H) Immunoblot analysis of P20 in SNs, pro-casp1, and NEK7 in input from NEK7 knockout iBMDMs recombined with mouse WT or R121A mutant NEK7 and then stimulated with 5 mM nigericin for 2 h. Data are representative of one replicate of five independent experiments and show as mean ± SEM. Statistical analysis was performed using two-way ANOVA (A, F, and G). *p < 0.05, ***p < 0.001; NS, not significant, p > 0.05.
    Figure Legend Snippet: Figure 4. ENB binds to R121 of NEK7 (A) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with various doses of ENB for 15 min and then washed three times and stimulated with 5 mM nigericin for 30 min. (B) Docking complex of NEK7 with ENB. ENB is shown as sticks and colored light green, NEK7 is showed in cartoon and colored light gray, and key amino acid residues are shown as sticks. (C) 2D binding mode diagrams of NEK7 and ENB. (D) DARTS and immunoblot analysis of NEK7 in HEK293T cells transfected with WT, I40A, or R121A mutant FLAG-NEK7 and then treated with 200 mM ENB and pronase (25 ng/mg of protein). (E) IP and immunoblot analysis of HEK293T cells transfected with VSV-NLRP3, WT, or R121A mutant FLAG-NEK7 plasmids as indicated and treated with 2 mM ENB. (F) ELISA analysis of IL-1b in SNs from NEK7 knockout THP-1 cells recombined with human WT or R121A mutant NEK7 and then stimulated with 5 mM nigericin for 1 h. (G) ELISA of IL-1b in SNs from NEK7 knockout iBMDMs recombined with mouse WT or R121A mutant NEK7 and then stimulated with 5 mM nigericin for 2 h. (H) Immunoblot analysis of P20 in SNs, pro-casp1, and NEK7 in input from NEK7 knockout iBMDMs recombined with mouse WT or R121A mutant NEK7 and then stimulated with 5 mM nigericin for 2 h. Data are representative of one replicate of five independent experiments and show as mean ± SEM. Statistical analysis was performed using two-way ANOVA (A, F, and G). *p < 0.05, ***p < 0.001; NS, not significant, p > 0.05.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Binding Assay, Western Blot, Transfection, Mutagenesis, Knock-Out

    Figure 5. ENB has therapeutic effects in a mouse model of LPS-induced systemic inflammation and MSU-induced peritonitis (A) Survival analysis of C57BL/6 mice pretreated with vehicle or ENB (10 mg/kg) for 1 h before being intraperitoneally injected with LPS. n = 10 biologically in- dependent mice. (B and C) ELISA of IL-1b (B) and TNF-a (C) in serum of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with LPS. N = 5 biologically independent mice. (D) Hematoxylin and eosin (H&E) staining in liver cross-sections from C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with LPS. (E and F) Serum AST (E) and ALT (F) levels of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with LPS. n = 5 biologically independent mice. (G) Statistical analysis of neutrophil numbers in the peritoneal cavity of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with MSU. n = 5 biologically independent mice. (H) ELISA analysis of IL-1b in the peritoneal cavity of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with MSU. n = 5 biologically independent mice. Data represent mean ± SEM. Statistical analysis was performed using generalized Wilcoxon test (A) or one-way ANOVA (B, C, and E–H). *p < 0.05, **p < 0.01, ***p < 0.001; NS, p > 0.05.
    Figure Legend Snippet: Figure 5. ENB has therapeutic effects in a mouse model of LPS-induced systemic inflammation and MSU-induced peritonitis (A) Survival analysis of C57BL/6 mice pretreated with vehicle or ENB (10 mg/kg) for 1 h before being intraperitoneally injected with LPS. n = 10 biologically in- dependent mice. (B and C) ELISA of IL-1b (B) and TNF-a (C) in serum of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with LPS. N = 5 biologically independent mice. (D) Hematoxylin and eosin (H&E) staining in liver cross-sections from C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with LPS. (E and F) Serum AST (E) and ALT (F) levels of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with LPS. n = 5 biologically independent mice. (G) Statistical analysis of neutrophil numbers in the peritoneal cavity of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with MSU. n = 5 biologically independent mice. (H) ELISA analysis of IL-1b in the peritoneal cavity of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with MSU. n = 5 biologically independent mice. Data represent mean ± SEM. Statistical analysis was performed using generalized Wilcoxon test (A) or one-way ANOVA (B, C, and E–H). *p < 0.05, **p < 0.01, ***p < 0.001; NS, p > 0.05.

    Techniques Used: Injection, Enzyme-linked Immunosorbent Assay, Staining

    Figure 6. ENB has preventive effects in mouse models of HFD-induced T2D (A) Body weights of C57BL/6 mice were measured at the indicated time points after initiation of the HFD with or without ENB treatment. n = 6 biologically in- dependent mice. (B) Fasting blood glucose concentrations of C57BL/6 mice were measured at the indicated time points after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (C) Fasting blood insulin concentrations of C57BL/6 mice were measured at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (D and E) Glucose tolerance test (GTT) (D) and insulin tolerance test (ITT) (E) of C57BL/6 mice were performed at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (F) ELISA analysis of IL-1b in serum of C57BL/6J mice were measured at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (G) ELISA of IL-1b in liver cultured SNs of C57BL/6 mice at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (H) Immunoblot analysis of P20 and GSDMD in liver of C57BL/6 mice at week 16 after initiation of the HFD with or without ENB treatment. (I) ELISA of IL-1b in white adipose tissue (WAT) culture SNs of C57BL/6 mice at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. Data represent mean ± SEM. Statistical analysis was performed using two-way ANOVA (A–G and I). *p < 0.05, **p < 0.01, ***p < 0.001.
    Figure Legend Snippet: Figure 6. ENB has preventive effects in mouse models of HFD-induced T2D (A) Body weights of C57BL/6 mice were measured at the indicated time points after initiation of the HFD with or without ENB treatment. n = 6 biologically in- dependent mice. (B) Fasting blood glucose concentrations of C57BL/6 mice were measured at the indicated time points after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (C) Fasting blood insulin concentrations of C57BL/6 mice were measured at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (D and E) Glucose tolerance test (GTT) (D) and insulin tolerance test (ITT) (E) of C57BL/6 mice were performed at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (F) ELISA analysis of IL-1b in serum of C57BL/6J mice were measured at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (G) ELISA of IL-1b in liver cultured SNs of C57BL/6 mice at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (H) Immunoblot analysis of P20 and GSDMD in liver of C57BL/6 mice at week 16 after initiation of the HFD with or without ENB treatment. (I) ELISA of IL-1b in white adipose tissue (WAT) culture SNs of C57BL/6 mice at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. Data represent mean ± SEM. Statistical analysis was performed using two-way ANOVA (A–G and I). *p < 0.05, **p < 0.01, ***p < 0.001.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Cell Culture, Western Blot

    Figure 7. ENB has therapeutic effects in mouse models of HFD-induced T2D (A) Body weights of C57BL/6 mice were measured at the indicated time points after initiation of the HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (B and C) Fasting blood glucose (B) and fed blood glucose (C) concentrations of C57BL/6 mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (D and E) GTT (D) and ITT (E) of C57BL/6 mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (F) ELISA of IL-1b in serum of C57BL/6J mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (G) Representative H&E and oil red O staining of liver sections of C57BL/6J mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. (H and I) ELISA analysis of IL-1b in liver (H) and WAT (I) culture SNs of C57BL/6 mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. Data represent mean ± SEM. Statistical analysis was performed using two-way ANOVA (A–F, H, and I). *p < 0.05, **p < 0.01, ***p < 0.001.
    Figure Legend Snippet: Figure 7. ENB has therapeutic effects in mouse models of HFD-induced T2D (A) Body weights of C57BL/6 mice were measured at the indicated time points after initiation of the HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (B and C) Fasting blood glucose (B) and fed blood glucose (C) concentrations of C57BL/6 mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (D and E) GTT (D) and ITT (E) of C57BL/6 mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (F) ELISA of IL-1b in serum of C57BL/6J mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (G) Representative H&E and oil red O staining of liver sections of C57BL/6J mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. (H and I) ELISA analysis of IL-1b in liver (H) and WAT (I) culture SNs of C57BL/6 mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. Data represent mean ± SEM. Statistical analysis was performed using two-way ANOVA (A–F, H, and I). *p < 0.05, **p < 0.01, ***p < 0.001.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Staining

    Related Articles

    Recombinant:

    Article Title: Entrectinib inhibits NLRP3 inflammasome and inflammatory diseases by directly targeting NEK7.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse IL-1b R&D Systems CatAF-401-NA; RRID:AB_416684 Anti-mouse caspase-1 Adipogen Cat#AG-20B-0042; RRID:AB_2490248 Anti-human IL-1b Proteintech Cat#60136-1-Ig; RRID:AB_10597543 Anti-human caspase-1 Cell Signaling Technology Cat#2225; RRID:AB_2243894 Anti-NLRP3 Adipogen Cat#AG-20B-0014; RRID:AB_2885199 Anti-b-actin Abmart Cat#P30002; RRID:AB_2222847 Anti-ASC Cell Signaling Technology Cat#67824; RRID:AB_2799736 Anti-NEK7 Santa Cruz Cat#SC-50756; RRID:AB_2235871 Anti-NEK6 Abcam Cat#ab133494; RRID:AB_11155676 Anti-NEK9 Abcam Cat# ab18332, RRID:AB_444424 Anti-GSDMD Abcam Cat#ab219800; RRID:AB_2888940 Anti-VSV Sigma Cat#V4888; RRID:AB_261872 Anti-Flag Sigma Cat#F2555; RRID:AB_796202 Chemicals, peptides, and recombinant proteins Entrectinib TargetMol Cat#T3678 Repotrectinib TargetMol Cat#T4071 Belizatinib TargetMol Cat#T4257 Larotrectinib TargetMol Cat#T5995 Val-boroPro TargetMol Cat#T37861 MSU Sigma Cat#69-93-2 ATP Sigma Cat#34369-07-8 PMA (phorbol-12-myristate-13-acetate) Sigma Cat#P8139 Poly (dA:dT) Sigma Cat#86828-69-5 Protein G agarose Sigma Cat#P7700 Propidium iodide (PI) Sigma Cat#P4170 b-hydroxybutyrate (BHB) Sigma Cat#52017 Pronase Sigma Cat#P5147 Imiquimod MedChemExpress Cat#HY-B0180 Nigericin MedChemExpress Cat#HY-127019 MCC950 MedChemExpress Cat#HY-12815 CY-09 MedChemExpress Cat#HY-103666 Tranilast MedChemExpress Cat#HY-B0195 Tivantinib MedChemExpress Cat#HY-50686 b-Estradiol MedChemExpress Cat#HY-B0141 Alum Thermo Fisher Scientific Cat#77161 Mitotracker Thermo Fisher Scientific Cat#M7512 Pam3CSK4 Invivogen Cat#tlrl-pms LPS Invivogen Cat#tlrl-peklps MitoSOX Invitrogen Cat#M36008 DAPI Invitrogen Cat#D21490 MQAE Invitrogen Cat#162558-52-3 Lipofectamine 2000 Invitrogen Cat#11668019 SiO2 InvivoGen Cat#tlrl-sio-2 (Continued on next page) e1 Cell Reports Medicine 4, 101310, December 19, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse M-CSF Novoprotein Cat#CB34 Human M-CSF Novoprotein Cat#C417 Human IL-3 Novoprotein Cat#CF63 Critical commercial assays LDH Cytotoxicity Assay Kit Beyotime Cat#C0017 Mouse IL-1b ELISA kit R&D Cat#DY401 Mouse TNF-alpha ELISA kit R&D Cat#DY410 Mouse IL-6 ELISA kit R&D Cat#DY406 Human IL-1b ELISA kit R&D Cat#DY201 Experimental models: Cell lines HEK-293T ATCC ATCC Cat#CRL-3216 THP-1 ATCC ATCC Cat#TIB-202 RAW 264.7 ATCC ATCC Cat#TIB-71 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory 000664 Oligonucleotides Mouse ROS1 forward Sangon 50TGGTACCTACTA TCCCTGGA’ Mouse ROS1 reverse Sangon 50TCCTTTCCCAAG TGAAGGCC’ Mouse Gapdh forward Sangon 50GGTGAAGGTCGGTGTGAACG30 Mouse Gapdh reverse Sangon 50CTCGCTCCTGGAAGATGGTG30 Software and algorithms EndNote X8 EndNote Software https://endnote.com/ Grahpad Prism (v9) GraphPad Software https://www.graphpad.com/ ImageJ 1.47v National Institutes of Health https://imagej.nih.gov/ij/ BioRender BioRender software https://www.biorender.com/



    Similar Products

    98
    R&D Systems resource source identifier antibodies anti mouse il 1b r d systems cat
    Figure 1. Identification of ENB as a potent inhibitor of the NLRP3 inflammasome (A–C) ELISA analysis of <t>IL-1b</t> in culture supernatants (SNs) from LPS-primed BMDMs treated with various doses of ENB and then stimulated with 150 mg/mL MSU for 4 h (A), 5 mM nigericin (B), or 2.5 mM ATP (C) for 30 min. (D) Immunoblot analysis of IL-1b and cleaved caspase-1 (P20) in SN, pro-IL-1b and pro-caspase-1 (Pro-casp1) in cell lysates (input) from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (E) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (F) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (G) ELISA of IL-1b in SN from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (H) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. (I) ELISA of IL-1b in SNs from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. Data represent the mean ± SEM of three (A–C and E) or four (G and I) technical replicates from one of five independent experiments. Statistical analysis was performed using one-way ANOVA (G and I) or two-way ANOVA (E). *p < 0.05, **p < 0.01, ***p < 0.001.
    Resource Source Identifier Antibodies Anti Mouse Il 1b R D Systems Cat, supplied by R&D Systems, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+anti+mouse+il+1b+r+d+systems+cat/Mouse+IL-1+beta%2FIL-1F2+Antibody/pm38118409-163-2-8
    Average 98 stars, based on 1 article reviews
    resource source identifier antibodies anti mouse il 1b r d systems cat - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    92
    R&D Systems resource source identifier antibodies anti mouse il 1b antibody r d systems cat
    Figure 1. Identification of ENB as a potent inhibitor of the NLRP3 inflammasome (A–C) ELISA analysis of <t>IL-1b</t> in culture supernatants (SNs) from LPS-primed BMDMs treated with various doses of ENB and then stimulated with 150 mg/mL MSU for 4 h (A), 5 mM nigericin (B), or 2.5 mM ATP (C) for 30 min. (D) Immunoblot analysis of IL-1b and cleaved caspase-1 (P20) in SN, pro-IL-1b and pro-caspase-1 (Pro-casp1) in cell lysates (input) from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (E) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (F) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (G) ELISA of IL-1b in SN from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (H) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. (I) ELISA of IL-1b in SNs from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. Data represent the mean ± SEM of three (A–C and E) or four (G and I) technical replicates from one of five independent experiments. Statistical analysis was performed using one-way ANOVA (G and I) or two-way ANOVA (E). *p < 0.05, **p < 0.01, ***p < 0.001.
    Resource Source Identifier Antibodies Anti Mouse Il 1b Antibody R D Systems Cat, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/resource+source+identifier+antibodies+anti+mouse+il+1b+r+d+systems+cat/Human+CCR2+Antibody/pm30463019-280-2-9
    Average 92 stars, based on 1 article reviews
    resource source identifier antibodies anti mouse il 1b antibody r d systems cat - by Bioz Stars, 2026-10
    92/100 stars
      Buy from Supplier

    Image Search Results


    Figure 1. Identification of ENB as a potent inhibitor of the NLRP3 inflammasome (A–C) ELISA analysis of IL-1b in culture supernatants (SNs) from LPS-primed BMDMs treated with various doses of ENB and then stimulated with 150 mg/mL MSU for 4 h (A), 5 mM nigericin (B), or 2.5 mM ATP (C) for 30 min. (D) Immunoblot analysis of IL-1b and cleaved caspase-1 (P20) in SN, pro-IL-1b and pro-caspase-1 (Pro-casp1) in cell lysates (input) from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (E) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (F) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (G) ELISA of IL-1b in SN from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (H) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. (I) ELISA of IL-1b in SNs from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. Data represent the mean ± SEM of three (A–C and E) or four (G and I) technical replicates from one of five independent experiments. Statistical analysis was performed using one-way ANOVA (G and I) or two-way ANOVA (E). *p < 0.05, **p < 0.01, ***p < 0.001.

    Journal: Cell reports. Medicine

    Article Title: Entrectinib inhibits NLRP3 inflammasome and inflammatory diseases by directly targeting NEK7.

    doi: 10.1016/j.xcrm.2023.101310

    Figure Lengend Snippet: Figure 1. Identification of ENB as a potent inhibitor of the NLRP3 inflammasome (A–C) ELISA analysis of IL-1b in culture supernatants (SNs) from LPS-primed BMDMs treated with various doses of ENB and then stimulated with 150 mg/mL MSU for 4 h (A), 5 mM nigericin (B), or 2.5 mM ATP (C) for 30 min. (D) Immunoblot analysis of IL-1b and cleaved caspase-1 (P20) in SN, pro-IL-1b and pro-caspase-1 (Pro-casp1) in cell lysates (input) from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (E) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 15 mg/mL imiquimod for 3 h or 300 mg/mL alum or SiO2 for 6 h. (F) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (G) ELISA of IL-1b in SN from Pam3CSK4-primed BMDMs treated with various doses of ENB and then transfected with 0.5 mg/mL LPS for 16 h. (H) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. (I) ELISA of IL-1b in SNs from PBMCs treated with various doses of ENB and then stimulated with 1 mg/mL LPS for 24 h. Data represent the mean ± SEM of three (A–C and E) or four (G and I) technical replicates from one of five independent experiments. Statistical analysis was performed using one-way ANOVA (G and I) or two-way ANOVA (E). *p < 0.05, **p < 0.01, ***p < 0.001.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse IL-1b R&D Systems Cat#AF-401-NA; RRID:AB_416684 Anti-mouse caspase-1 Adipogen Cat#AG-20B-0042; RRID:AB_2490248 Anti-human IL-1b Proteintech Cat#60136-1-Ig; RRID:AB_10597543 Anti-human caspase-1 Cell Signaling Technology Cat#2225; RRID:AB_2243894 Anti-NLRP3 Adipogen Cat#AG-20B-0014; RRID:AB_2885199 Anti-b-actin Abmart Cat#P30002; RRID:AB_2222847 Anti-ASC Cell Signaling Technology Cat#67824; RRID:AB_2799736 Anti-NEK7 Santa Cruz Cat#SC-50756; RRID:AB_2235871 Anti-NEK6 Abcam Cat#ab133494; RRID:AB_11155676 Anti-NEK9 Abcam Cat# ab18332, RRID:AB_444424 Anti-GSDMD Abcam Cat#ab219800; RRID:AB_2888940 Anti-VSV Sigma Cat#V4888; RRID:AB_261872 Anti-Flag Sigma Cat#F2555; RRID:AB_796202 Chemicals, peptides, and recombinant proteins Entrectinib TargetMol Cat#T3678 Repotrectinib TargetMol Cat#T4071 Belizatinib TargetMol Cat#T4257 Larotrectinib TargetMol Cat#T5995 Val-boroPro TargetMol Cat#T37861 MSU Sigma Cat#69-93-2 ATP Sigma Cat#34369-07-8 PMA (phorbol-12-myristate-13-acetate) Sigma Cat#P8139 Poly (dA:dT) Sigma Cat#86828-69-5 Protein G agarose Sigma Cat#P7700 Propidium iodide (PI) Sigma Cat#P4170 b-hydroxybutyrate (BHB) Sigma Cat#52017 Pronase Sigma Cat#P5147 Imiquimod MedChemExpress Cat#HY-B0180 Nigericin MedChemExpress Cat#HY-127019 MCC950 MedChemExpress Cat#HY-12815 CY-09 MedChemExpress Cat#HY-103666 Tranilast MedChemExpress Cat#HY-B0195 Tivantinib MedChemExpress Cat#HY-50686 b-Estradiol MedChemExpress Cat#HY-B0141 Alum Thermo Fisher Scientific Cat#77161 Mitotracker Thermo Fisher Scientific Cat#M7512 Pam3CSK4 Invivogen Cat#tlrl-pms LPS Invivogen Cat#tlrl-peklps MitoSOX Invitrogen Cat#M36008 DAPI Invitrogen Cat#D21490 MQAE Invitrogen Cat#162558-52-3 Lipofectamine 2000 Invitrogen Cat#11668019 SiO2 InvivoGen Cat#tlrl-sio-2 (Continued on next page) e1 Cell Reports Medicine 4, 101310, December 19, 2023

    Techniques: Enzyme-linked Immunosorbent Assay, Western Blot, Transfection

    Figure 2. ENB specifically inhibits NLRP3 without affecting activation of other inflammasomes (A) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or transfected with 0.5 mg/mL poly(dA:dT) for 4 h. (B) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or transfected with 0.5 mg/mL poly(dA:dT) for 4 h. (C) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and Pro-casp1 in input from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or infected with Salmonella (multiplicity of infection [MOI] = 5) for 4 h. (D) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or infected with Salmonella (MOI = 5) for 4 h. (E) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or 0.5 mg/mL C. difficile toxin B (TcdB) for 1 h or infected with L. monocytogenes (Listeria; MOI = 10) for 4 h. (F) ELISA of IL-1b in SNs from phorbol 12-myristate 13-acetate (PMA)-differentiated and LPS-primed THP-1 cells treated with 2 mM ENB and then stimulated with 5 mM nigericin for 1 h or 10 mM Val-boroPro (VbP) for 24 h. (G) Immunoblot analysis of NLRP3 and pro-IL-1b in input from BMDMs treated with various doses of ENB and then stimulated with 50 ng/mL LPS for 3 h. (H and I) ELISA of TNF-a (H) and IL-6 (I) in SNs from BMDMs treated with various doses of ENB and then stimulated with 50 ng/mL LPS for 3 h. Data represent the mean ± SEM of four technical replicates from one of five independent experiments. Statistical analysis was performed using two-way ANOVA (B and D–F). ***p < 0.001.

    Journal: Cell reports. Medicine

    Article Title: Entrectinib inhibits NLRP3 inflammasome and inflammatory diseases by directly targeting NEK7.

    doi: 10.1016/j.xcrm.2023.101310

    Figure Lengend Snippet: Figure 2. ENB specifically inhibits NLRP3 without affecting activation of other inflammasomes (A) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and pro-casp1 in input from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or transfected with 0.5 mg/mL poly(dA:dT) for 4 h. (B) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or transfected with 0.5 mg/mL poly(dA:dT) for 4 h. (C) Immunoblot analysis of IL-1b and P20 in SNs and pro-IL-1b and Pro-casp1 in input from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or infected with Salmonella (multiplicity of infection [MOI] = 5) for 4 h. (D) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or infected with Salmonella (MOI = 5) for 4 h. (E) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min or 0.5 mg/mL C. difficile toxin B (TcdB) for 1 h or infected with L. monocytogenes (Listeria; MOI = 10) for 4 h. (F) ELISA of IL-1b in SNs from phorbol 12-myristate 13-acetate (PMA)-differentiated and LPS-primed THP-1 cells treated with 2 mM ENB and then stimulated with 5 mM nigericin for 1 h or 10 mM Val-boroPro (VbP) for 24 h. (G) Immunoblot analysis of NLRP3 and pro-IL-1b in input from BMDMs treated with various doses of ENB and then stimulated with 50 ng/mL LPS for 3 h. (H and I) ELISA of TNF-a (H) and IL-6 (I) in SNs from BMDMs treated with various doses of ENB and then stimulated with 50 ng/mL LPS for 3 h. Data represent the mean ± SEM of four technical replicates from one of five independent experiments. Statistical analysis was performed using two-way ANOVA (B and D–F). ***p < 0.001.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse IL-1b R&D Systems Cat#AF-401-NA; RRID:AB_416684 Anti-mouse caspase-1 Adipogen Cat#AG-20B-0042; RRID:AB_2490248 Anti-human IL-1b Proteintech Cat#60136-1-Ig; RRID:AB_10597543 Anti-human caspase-1 Cell Signaling Technology Cat#2225; RRID:AB_2243894 Anti-NLRP3 Adipogen Cat#AG-20B-0014; RRID:AB_2885199 Anti-b-actin Abmart Cat#P30002; RRID:AB_2222847 Anti-ASC Cell Signaling Technology Cat#67824; RRID:AB_2799736 Anti-NEK7 Santa Cruz Cat#SC-50756; RRID:AB_2235871 Anti-NEK6 Abcam Cat#ab133494; RRID:AB_11155676 Anti-NEK9 Abcam Cat# ab18332, RRID:AB_444424 Anti-GSDMD Abcam Cat#ab219800; RRID:AB_2888940 Anti-VSV Sigma Cat#V4888; RRID:AB_261872 Anti-Flag Sigma Cat#F2555; RRID:AB_796202 Chemicals, peptides, and recombinant proteins Entrectinib TargetMol Cat#T3678 Repotrectinib TargetMol Cat#T4071 Belizatinib TargetMol Cat#T4257 Larotrectinib TargetMol Cat#T5995 Val-boroPro TargetMol Cat#T37861 MSU Sigma Cat#69-93-2 ATP Sigma Cat#34369-07-8 PMA (phorbol-12-myristate-13-acetate) Sigma Cat#P8139 Poly (dA:dT) Sigma Cat#86828-69-5 Protein G agarose Sigma Cat#P7700 Propidium iodide (PI) Sigma Cat#P4170 b-hydroxybutyrate (BHB) Sigma Cat#52017 Pronase Sigma Cat#P5147 Imiquimod MedChemExpress Cat#HY-B0180 Nigericin MedChemExpress Cat#HY-127019 MCC950 MedChemExpress Cat#HY-12815 CY-09 MedChemExpress Cat#HY-103666 Tranilast MedChemExpress Cat#HY-B0195 Tivantinib MedChemExpress Cat#HY-50686 b-Estradiol MedChemExpress Cat#HY-B0141 Alum Thermo Fisher Scientific Cat#77161 Mitotracker Thermo Fisher Scientific Cat#M7512 Pam3CSK4 Invivogen Cat#tlrl-pms LPS Invivogen Cat#tlrl-peklps MitoSOX Invitrogen Cat#M36008 DAPI Invitrogen Cat#D21490 MQAE Invitrogen Cat#162558-52-3 Lipofectamine 2000 Invitrogen Cat#11668019 SiO2 InvivoGen Cat#tlrl-sio-2 (Continued on next page) e1 Cell Reports Medicine 4, 101310, December 19, 2023

    Techniques: Activation Assay, Western Blot, Transfection, Enzyme-linked Immunosorbent Assay, Infection

    Figure 3. ENB suppresses NLRP3 inflammasome assembly by directly targeting NEK7 (A) Immunoblot analysis of ASC oligomerization in cross-linked cytosolic pellets of LPS-primed BMDMs treated with various doses of ENB and then stimulated with 5 mM nigericin for 30 min. (B and C) Immunoprecipitation (IP) and immunoblot analysis of the interaction between endogenous ASC (B) or NEK7 (C) and NLRP3 in LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min. (D) IP and immunoblot analysis of HEK293T cells transfected with VSV-NLRP3, FLAG-NEK7, or empty vector plasmids as indicated and treated with 2 mM ENB or 1 mM MCC950. (E) Drug affinity responsive target stability (DARTS) and immunoblot analysis of NEK7, NLRP3, ASC, and pro-casp1 in LPS-primed BMDMs treated with 200 mM ENB and then performed with pronase (25 ng/mg of protein). (F) DARTS and immunoblot analysis of NEK7 in HEK293T cells transfected with GFP-NEK7 and then treated with 200 mM ENB and pronase (25 ng/mg of protein). (G) Cellular thermal shift assays (CETSAs) and immunoblot analysis of NEK7 stability in LPS-primed BMDMs treated with 200 mM ENB at different temperatures. (H) Immunoblot analysis of IL-1b and P20 in SNs, pro-IL-1b, and pro-casp1 in input from pam3CSK4-primed human BLaER1 monocytes treated with various doses of ENB and then stimulated with 5 mM nigericin for 2 h. (I) ELISA of IL-1b in SNs from pam3CSK4-primed human BLaER1 monocytes treated with various doses of ENB and then stimulated with 5 mM nigericin for 2 h. Data represent the mean ± SEM of four technical replicates from one of five independent experiments (I).

    Journal: Cell reports. Medicine

    Article Title: Entrectinib inhibits NLRP3 inflammasome and inflammatory diseases by directly targeting NEK7.

    doi: 10.1016/j.xcrm.2023.101310

    Figure Lengend Snippet: Figure 3. ENB suppresses NLRP3 inflammasome assembly by directly targeting NEK7 (A) Immunoblot analysis of ASC oligomerization in cross-linked cytosolic pellets of LPS-primed BMDMs treated with various doses of ENB and then stimulated with 5 mM nigericin for 30 min. (B and C) Immunoprecipitation (IP) and immunoblot analysis of the interaction between endogenous ASC (B) or NEK7 (C) and NLRP3 in LPS-primed BMDMs treated with 2 mM ENB and then stimulated with 5 mM nigericin for 30 min. (D) IP and immunoblot analysis of HEK293T cells transfected with VSV-NLRP3, FLAG-NEK7, or empty vector plasmids as indicated and treated with 2 mM ENB or 1 mM MCC950. (E) Drug affinity responsive target stability (DARTS) and immunoblot analysis of NEK7, NLRP3, ASC, and pro-casp1 in LPS-primed BMDMs treated with 200 mM ENB and then performed with pronase (25 ng/mg of protein). (F) DARTS and immunoblot analysis of NEK7 in HEK293T cells transfected with GFP-NEK7 and then treated with 200 mM ENB and pronase (25 ng/mg of protein). (G) Cellular thermal shift assays (CETSAs) and immunoblot analysis of NEK7 stability in LPS-primed BMDMs treated with 200 mM ENB at different temperatures. (H) Immunoblot analysis of IL-1b and P20 in SNs, pro-IL-1b, and pro-casp1 in input from pam3CSK4-primed human BLaER1 monocytes treated with various doses of ENB and then stimulated with 5 mM nigericin for 2 h. (I) ELISA of IL-1b in SNs from pam3CSK4-primed human BLaER1 monocytes treated with various doses of ENB and then stimulated with 5 mM nigericin for 2 h. Data represent the mean ± SEM of four technical replicates from one of five independent experiments (I).

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse IL-1b R&D Systems Cat#AF-401-NA; RRID:AB_416684 Anti-mouse caspase-1 Adipogen Cat#AG-20B-0042; RRID:AB_2490248 Anti-human IL-1b Proteintech Cat#60136-1-Ig; RRID:AB_10597543 Anti-human caspase-1 Cell Signaling Technology Cat#2225; RRID:AB_2243894 Anti-NLRP3 Adipogen Cat#AG-20B-0014; RRID:AB_2885199 Anti-b-actin Abmart Cat#P30002; RRID:AB_2222847 Anti-ASC Cell Signaling Technology Cat#67824; RRID:AB_2799736 Anti-NEK7 Santa Cruz Cat#SC-50756; RRID:AB_2235871 Anti-NEK6 Abcam Cat#ab133494; RRID:AB_11155676 Anti-NEK9 Abcam Cat# ab18332, RRID:AB_444424 Anti-GSDMD Abcam Cat#ab219800; RRID:AB_2888940 Anti-VSV Sigma Cat#V4888; RRID:AB_261872 Anti-Flag Sigma Cat#F2555; RRID:AB_796202 Chemicals, peptides, and recombinant proteins Entrectinib TargetMol Cat#T3678 Repotrectinib TargetMol Cat#T4071 Belizatinib TargetMol Cat#T4257 Larotrectinib TargetMol Cat#T5995 Val-boroPro TargetMol Cat#T37861 MSU Sigma Cat#69-93-2 ATP Sigma Cat#34369-07-8 PMA (phorbol-12-myristate-13-acetate) Sigma Cat#P8139 Poly (dA:dT) Sigma Cat#86828-69-5 Protein G agarose Sigma Cat#P7700 Propidium iodide (PI) Sigma Cat#P4170 b-hydroxybutyrate (BHB) Sigma Cat#52017 Pronase Sigma Cat#P5147 Imiquimod MedChemExpress Cat#HY-B0180 Nigericin MedChemExpress Cat#HY-127019 MCC950 MedChemExpress Cat#HY-12815 CY-09 MedChemExpress Cat#HY-103666 Tranilast MedChemExpress Cat#HY-B0195 Tivantinib MedChemExpress Cat#HY-50686 b-Estradiol MedChemExpress Cat#HY-B0141 Alum Thermo Fisher Scientific Cat#77161 Mitotracker Thermo Fisher Scientific Cat#M7512 Pam3CSK4 Invivogen Cat#tlrl-pms LPS Invivogen Cat#tlrl-peklps MitoSOX Invitrogen Cat#M36008 DAPI Invitrogen Cat#D21490 MQAE Invitrogen Cat#162558-52-3 Lipofectamine 2000 Invitrogen Cat#11668019 SiO2 InvivoGen Cat#tlrl-sio-2 (Continued on next page) e1 Cell Reports Medicine 4, 101310, December 19, 2023

    Techniques: Western Blot, Immunoprecipitation, Transfection, Plasmid Preparation, Enzyme-linked Immunosorbent Assay

    Figure 4. ENB binds to R121 of NEK7 (A) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with various doses of ENB for 15 min and then washed three times and stimulated with 5 mM nigericin for 30 min. (B) Docking complex of NEK7 with ENB. ENB is shown as sticks and colored light green, NEK7 is showed in cartoon and colored light gray, and key amino acid residues are shown as sticks. (C) 2D binding mode diagrams of NEK7 and ENB. (D) DARTS and immunoblot analysis of NEK7 in HEK293T cells transfected with WT, I40A, or R121A mutant FLAG-NEK7 and then treated with 200 mM ENB and pronase (25 ng/mg of protein). (E) IP and immunoblot analysis of HEK293T cells transfected with VSV-NLRP3, WT, or R121A mutant FLAG-NEK7 plasmids as indicated and treated with 2 mM ENB. (F) ELISA analysis of IL-1b in SNs from NEK7 knockout THP-1 cells recombined with human WT or R121A mutant NEK7 and then stimulated with 5 mM nigericin for 1 h. (G) ELISA of IL-1b in SNs from NEK7 knockout iBMDMs recombined with mouse WT or R121A mutant NEK7 and then stimulated with 5 mM nigericin for 2 h. (H) Immunoblot analysis of P20 in SNs, pro-casp1, and NEK7 in input from NEK7 knockout iBMDMs recombined with mouse WT or R121A mutant NEK7 and then stimulated with 5 mM nigericin for 2 h. Data are representative of one replicate of five independent experiments and show as mean ± SEM. Statistical analysis was performed using two-way ANOVA (A, F, and G). *p < 0.05, ***p < 0.001; NS, not significant, p > 0.05.

    Journal: Cell reports. Medicine

    Article Title: Entrectinib inhibits NLRP3 inflammasome and inflammatory diseases by directly targeting NEK7.

    doi: 10.1016/j.xcrm.2023.101310

    Figure Lengend Snippet: Figure 4. ENB binds to R121 of NEK7 (A) ELISA of IL-1b in SNs from LPS-primed BMDMs treated with various doses of ENB for 15 min and then washed three times and stimulated with 5 mM nigericin for 30 min. (B) Docking complex of NEK7 with ENB. ENB is shown as sticks and colored light green, NEK7 is showed in cartoon and colored light gray, and key amino acid residues are shown as sticks. (C) 2D binding mode diagrams of NEK7 and ENB. (D) DARTS and immunoblot analysis of NEK7 in HEK293T cells transfected with WT, I40A, or R121A mutant FLAG-NEK7 and then treated with 200 mM ENB and pronase (25 ng/mg of protein). (E) IP and immunoblot analysis of HEK293T cells transfected with VSV-NLRP3, WT, or R121A mutant FLAG-NEK7 plasmids as indicated and treated with 2 mM ENB. (F) ELISA analysis of IL-1b in SNs from NEK7 knockout THP-1 cells recombined with human WT or R121A mutant NEK7 and then stimulated with 5 mM nigericin for 1 h. (G) ELISA of IL-1b in SNs from NEK7 knockout iBMDMs recombined with mouse WT or R121A mutant NEK7 and then stimulated with 5 mM nigericin for 2 h. (H) Immunoblot analysis of P20 in SNs, pro-casp1, and NEK7 in input from NEK7 knockout iBMDMs recombined with mouse WT or R121A mutant NEK7 and then stimulated with 5 mM nigericin for 2 h. Data are representative of one replicate of five independent experiments and show as mean ± SEM. Statistical analysis was performed using two-way ANOVA (A, F, and G). *p < 0.05, ***p < 0.001; NS, not significant, p > 0.05.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse IL-1b R&D Systems Cat#AF-401-NA; RRID:AB_416684 Anti-mouse caspase-1 Adipogen Cat#AG-20B-0042; RRID:AB_2490248 Anti-human IL-1b Proteintech Cat#60136-1-Ig; RRID:AB_10597543 Anti-human caspase-1 Cell Signaling Technology Cat#2225; RRID:AB_2243894 Anti-NLRP3 Adipogen Cat#AG-20B-0014; RRID:AB_2885199 Anti-b-actin Abmart Cat#P30002; RRID:AB_2222847 Anti-ASC Cell Signaling Technology Cat#67824; RRID:AB_2799736 Anti-NEK7 Santa Cruz Cat#SC-50756; RRID:AB_2235871 Anti-NEK6 Abcam Cat#ab133494; RRID:AB_11155676 Anti-NEK9 Abcam Cat# ab18332, RRID:AB_444424 Anti-GSDMD Abcam Cat#ab219800; RRID:AB_2888940 Anti-VSV Sigma Cat#V4888; RRID:AB_261872 Anti-Flag Sigma Cat#F2555; RRID:AB_796202 Chemicals, peptides, and recombinant proteins Entrectinib TargetMol Cat#T3678 Repotrectinib TargetMol Cat#T4071 Belizatinib TargetMol Cat#T4257 Larotrectinib TargetMol Cat#T5995 Val-boroPro TargetMol Cat#T37861 MSU Sigma Cat#69-93-2 ATP Sigma Cat#34369-07-8 PMA (phorbol-12-myristate-13-acetate) Sigma Cat#P8139 Poly (dA:dT) Sigma Cat#86828-69-5 Protein G agarose Sigma Cat#P7700 Propidium iodide (PI) Sigma Cat#P4170 b-hydroxybutyrate (BHB) Sigma Cat#52017 Pronase Sigma Cat#P5147 Imiquimod MedChemExpress Cat#HY-B0180 Nigericin MedChemExpress Cat#HY-127019 MCC950 MedChemExpress Cat#HY-12815 CY-09 MedChemExpress Cat#HY-103666 Tranilast MedChemExpress Cat#HY-B0195 Tivantinib MedChemExpress Cat#HY-50686 b-Estradiol MedChemExpress Cat#HY-B0141 Alum Thermo Fisher Scientific Cat#77161 Mitotracker Thermo Fisher Scientific Cat#M7512 Pam3CSK4 Invivogen Cat#tlrl-pms LPS Invivogen Cat#tlrl-peklps MitoSOX Invitrogen Cat#M36008 DAPI Invitrogen Cat#D21490 MQAE Invitrogen Cat#162558-52-3 Lipofectamine 2000 Invitrogen Cat#11668019 SiO2 InvivoGen Cat#tlrl-sio-2 (Continued on next page) e1 Cell Reports Medicine 4, 101310, December 19, 2023

    Techniques: Enzyme-linked Immunosorbent Assay, Binding Assay, Western Blot, Transfection, Mutagenesis, Knock-Out

    Figure 5. ENB has therapeutic effects in a mouse model of LPS-induced systemic inflammation and MSU-induced peritonitis (A) Survival analysis of C57BL/6 mice pretreated with vehicle or ENB (10 mg/kg) for 1 h before being intraperitoneally injected with LPS. n = 10 biologically in- dependent mice. (B and C) ELISA of IL-1b (B) and TNF-a (C) in serum of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with LPS. N = 5 biologically independent mice. (D) Hematoxylin and eosin (H&E) staining in liver cross-sections from C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with LPS. (E and F) Serum AST (E) and ALT (F) levels of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with LPS. n = 5 biologically independent mice. (G) Statistical analysis of neutrophil numbers in the peritoneal cavity of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with MSU. n = 5 biologically independent mice. (H) ELISA analysis of IL-1b in the peritoneal cavity of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with MSU. n = 5 biologically independent mice. Data represent mean ± SEM. Statistical analysis was performed using generalized Wilcoxon test (A) or one-way ANOVA (B, C, and E–H). *p < 0.05, **p < 0.01, ***p < 0.001; NS, p > 0.05.

    Journal: Cell reports. Medicine

    Article Title: Entrectinib inhibits NLRP3 inflammasome and inflammatory diseases by directly targeting NEK7.

    doi: 10.1016/j.xcrm.2023.101310

    Figure Lengend Snippet: Figure 5. ENB has therapeutic effects in a mouse model of LPS-induced systemic inflammation and MSU-induced peritonitis (A) Survival analysis of C57BL/6 mice pretreated with vehicle or ENB (10 mg/kg) for 1 h before being intraperitoneally injected with LPS. n = 10 biologically in- dependent mice. (B and C) ELISA of IL-1b (B) and TNF-a (C) in serum of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with LPS. N = 5 biologically independent mice. (D) Hematoxylin and eosin (H&E) staining in liver cross-sections from C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with LPS. (E and F) Serum AST (E) and ALT (F) levels of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with LPS. n = 5 biologically independent mice. (G) Statistical analysis of neutrophil numbers in the peritoneal cavity of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with MSU. n = 5 biologically independent mice. (H) ELISA analysis of IL-1b in the peritoneal cavity of C57BL/6J mice pretreated with vehicle or ENB for 1 h before being intraperitoneally injected with MSU. n = 5 biologically independent mice. Data represent mean ± SEM. Statistical analysis was performed using generalized Wilcoxon test (A) or one-way ANOVA (B, C, and E–H). *p < 0.05, **p < 0.01, ***p < 0.001; NS, p > 0.05.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse IL-1b R&D Systems Cat#AF-401-NA; RRID:AB_416684 Anti-mouse caspase-1 Adipogen Cat#AG-20B-0042; RRID:AB_2490248 Anti-human IL-1b Proteintech Cat#60136-1-Ig; RRID:AB_10597543 Anti-human caspase-1 Cell Signaling Technology Cat#2225; RRID:AB_2243894 Anti-NLRP3 Adipogen Cat#AG-20B-0014; RRID:AB_2885199 Anti-b-actin Abmart Cat#P30002; RRID:AB_2222847 Anti-ASC Cell Signaling Technology Cat#67824; RRID:AB_2799736 Anti-NEK7 Santa Cruz Cat#SC-50756; RRID:AB_2235871 Anti-NEK6 Abcam Cat#ab133494; RRID:AB_11155676 Anti-NEK9 Abcam Cat# ab18332, RRID:AB_444424 Anti-GSDMD Abcam Cat#ab219800; RRID:AB_2888940 Anti-VSV Sigma Cat#V4888; RRID:AB_261872 Anti-Flag Sigma Cat#F2555; RRID:AB_796202 Chemicals, peptides, and recombinant proteins Entrectinib TargetMol Cat#T3678 Repotrectinib TargetMol Cat#T4071 Belizatinib TargetMol Cat#T4257 Larotrectinib TargetMol Cat#T5995 Val-boroPro TargetMol Cat#T37861 MSU Sigma Cat#69-93-2 ATP Sigma Cat#34369-07-8 PMA (phorbol-12-myristate-13-acetate) Sigma Cat#P8139 Poly (dA:dT) Sigma Cat#86828-69-5 Protein G agarose Sigma Cat#P7700 Propidium iodide (PI) Sigma Cat#P4170 b-hydroxybutyrate (BHB) Sigma Cat#52017 Pronase Sigma Cat#P5147 Imiquimod MedChemExpress Cat#HY-B0180 Nigericin MedChemExpress Cat#HY-127019 MCC950 MedChemExpress Cat#HY-12815 CY-09 MedChemExpress Cat#HY-103666 Tranilast MedChemExpress Cat#HY-B0195 Tivantinib MedChemExpress Cat#HY-50686 b-Estradiol MedChemExpress Cat#HY-B0141 Alum Thermo Fisher Scientific Cat#77161 Mitotracker Thermo Fisher Scientific Cat#M7512 Pam3CSK4 Invivogen Cat#tlrl-pms LPS Invivogen Cat#tlrl-peklps MitoSOX Invitrogen Cat#M36008 DAPI Invitrogen Cat#D21490 MQAE Invitrogen Cat#162558-52-3 Lipofectamine 2000 Invitrogen Cat#11668019 SiO2 InvivoGen Cat#tlrl-sio-2 (Continued on next page) e1 Cell Reports Medicine 4, 101310, December 19, 2023

    Techniques: Injection, Enzyme-linked Immunosorbent Assay, Staining

    Figure 6. ENB has preventive effects in mouse models of HFD-induced T2D (A) Body weights of C57BL/6 mice were measured at the indicated time points after initiation of the HFD with or without ENB treatment. n = 6 biologically in- dependent mice. (B) Fasting blood glucose concentrations of C57BL/6 mice were measured at the indicated time points after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (C) Fasting blood insulin concentrations of C57BL/6 mice were measured at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (D and E) Glucose tolerance test (GTT) (D) and insulin tolerance test (ITT) (E) of C57BL/6 mice were performed at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (F) ELISA analysis of IL-1b in serum of C57BL/6J mice were measured at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (G) ELISA of IL-1b in liver cultured SNs of C57BL/6 mice at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (H) Immunoblot analysis of P20 and GSDMD in liver of C57BL/6 mice at week 16 after initiation of the HFD with or without ENB treatment. (I) ELISA of IL-1b in white adipose tissue (WAT) culture SNs of C57BL/6 mice at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. Data represent mean ± SEM. Statistical analysis was performed using two-way ANOVA (A–G and I). *p < 0.05, **p < 0.01, ***p < 0.001.

    Journal: Cell reports. Medicine

    Article Title: Entrectinib inhibits NLRP3 inflammasome and inflammatory diseases by directly targeting NEK7.

    doi: 10.1016/j.xcrm.2023.101310

    Figure Lengend Snippet: Figure 6. ENB has preventive effects in mouse models of HFD-induced T2D (A) Body weights of C57BL/6 mice were measured at the indicated time points after initiation of the HFD with or without ENB treatment. n = 6 biologically in- dependent mice. (B) Fasting blood glucose concentrations of C57BL/6 mice were measured at the indicated time points after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (C) Fasting blood insulin concentrations of C57BL/6 mice were measured at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (D and E) Glucose tolerance test (GTT) (D) and insulin tolerance test (ITT) (E) of C57BL/6 mice were performed at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (F) ELISA analysis of IL-1b in serum of C57BL/6J mice were measured at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (G) ELISA of IL-1b in liver cultured SNs of C57BL/6 mice at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. (H) Immunoblot analysis of P20 and GSDMD in liver of C57BL/6 mice at week 16 after initiation of the HFD with or without ENB treatment. (I) ELISA of IL-1b in white adipose tissue (WAT) culture SNs of C57BL/6 mice at week 16 after initiation of the HFD with or without ENB treatment. n = 6 biologically independent mice. Data represent mean ± SEM. Statistical analysis was performed using two-way ANOVA (A–G and I). *p < 0.05, **p < 0.01, ***p < 0.001.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse IL-1b R&D Systems Cat#AF-401-NA; RRID:AB_416684 Anti-mouse caspase-1 Adipogen Cat#AG-20B-0042; RRID:AB_2490248 Anti-human IL-1b Proteintech Cat#60136-1-Ig; RRID:AB_10597543 Anti-human caspase-1 Cell Signaling Technology Cat#2225; RRID:AB_2243894 Anti-NLRP3 Adipogen Cat#AG-20B-0014; RRID:AB_2885199 Anti-b-actin Abmart Cat#P30002; RRID:AB_2222847 Anti-ASC Cell Signaling Technology Cat#67824; RRID:AB_2799736 Anti-NEK7 Santa Cruz Cat#SC-50756; RRID:AB_2235871 Anti-NEK6 Abcam Cat#ab133494; RRID:AB_11155676 Anti-NEK9 Abcam Cat# ab18332, RRID:AB_444424 Anti-GSDMD Abcam Cat#ab219800; RRID:AB_2888940 Anti-VSV Sigma Cat#V4888; RRID:AB_261872 Anti-Flag Sigma Cat#F2555; RRID:AB_796202 Chemicals, peptides, and recombinant proteins Entrectinib TargetMol Cat#T3678 Repotrectinib TargetMol Cat#T4071 Belizatinib TargetMol Cat#T4257 Larotrectinib TargetMol Cat#T5995 Val-boroPro TargetMol Cat#T37861 MSU Sigma Cat#69-93-2 ATP Sigma Cat#34369-07-8 PMA (phorbol-12-myristate-13-acetate) Sigma Cat#P8139 Poly (dA:dT) Sigma Cat#86828-69-5 Protein G agarose Sigma Cat#P7700 Propidium iodide (PI) Sigma Cat#P4170 b-hydroxybutyrate (BHB) Sigma Cat#52017 Pronase Sigma Cat#P5147 Imiquimod MedChemExpress Cat#HY-B0180 Nigericin MedChemExpress Cat#HY-127019 MCC950 MedChemExpress Cat#HY-12815 CY-09 MedChemExpress Cat#HY-103666 Tranilast MedChemExpress Cat#HY-B0195 Tivantinib MedChemExpress Cat#HY-50686 b-Estradiol MedChemExpress Cat#HY-B0141 Alum Thermo Fisher Scientific Cat#77161 Mitotracker Thermo Fisher Scientific Cat#M7512 Pam3CSK4 Invivogen Cat#tlrl-pms LPS Invivogen Cat#tlrl-peklps MitoSOX Invitrogen Cat#M36008 DAPI Invitrogen Cat#D21490 MQAE Invitrogen Cat#162558-52-3 Lipofectamine 2000 Invitrogen Cat#11668019 SiO2 InvivoGen Cat#tlrl-sio-2 (Continued on next page) e1 Cell Reports Medicine 4, 101310, December 19, 2023

    Techniques: Enzyme-linked Immunosorbent Assay, Cell Culture, Western Blot

    Figure 7. ENB has therapeutic effects in mouse models of HFD-induced T2D (A) Body weights of C57BL/6 mice were measured at the indicated time points after initiation of the HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (B and C) Fasting blood glucose (B) and fed blood glucose (C) concentrations of C57BL/6 mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (D and E) GTT (D) and ITT (E) of C57BL/6 mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (F) ELISA of IL-1b in serum of C57BL/6J mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (G) Representative H&E and oil red O staining of liver sections of C57BL/6J mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. (H and I) ELISA analysis of IL-1b in liver (H) and WAT (I) culture SNs of C57BL/6 mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. Data represent mean ± SEM. Statistical analysis was performed using two-way ANOVA (A–F, H, and I). *p < 0.05, **p < 0.01, ***p < 0.001.

    Journal: Cell reports. Medicine

    Article Title: Entrectinib inhibits NLRP3 inflammasome and inflammatory diseases by directly targeting NEK7.

    doi: 10.1016/j.xcrm.2023.101310

    Figure Lengend Snippet: Figure 7. ENB has therapeutic effects in mouse models of HFD-induced T2D (A) Body weights of C57BL/6 mice were measured at the indicated time points after initiation of the HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (B and C) Fasting blood glucose (B) and fed blood glucose (C) concentrations of C57BL/6 mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (D and E) GTT (D) and ITT (E) of C57BL/6 mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (F) ELISA of IL-1b in serum of C57BL/6J mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. (G) Representative H&E and oil red O staining of liver sections of C57BL/6J mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. (H and I) ELISA analysis of IL-1b in liver (H) and WAT (I) culture SNs of C57BL/6 mice that were first fed with an HFD for 12 weeks and then treated with vehicle or ENB for 4 weeks. n = 6 biologically independent mice. Data represent mean ± SEM. Statistical analysis was performed using two-way ANOVA (A–F, H, and I). *p < 0.05, **p < 0.01, ***p < 0.001.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse IL-1b R&D Systems Cat#AF-401-NA; RRID:AB_416684 Anti-mouse caspase-1 Adipogen Cat#AG-20B-0042; RRID:AB_2490248 Anti-human IL-1b Proteintech Cat#60136-1-Ig; RRID:AB_10597543 Anti-human caspase-1 Cell Signaling Technology Cat#2225; RRID:AB_2243894 Anti-NLRP3 Adipogen Cat#AG-20B-0014; RRID:AB_2885199 Anti-b-actin Abmart Cat#P30002; RRID:AB_2222847 Anti-ASC Cell Signaling Technology Cat#67824; RRID:AB_2799736 Anti-NEK7 Santa Cruz Cat#SC-50756; RRID:AB_2235871 Anti-NEK6 Abcam Cat#ab133494; RRID:AB_11155676 Anti-NEK9 Abcam Cat# ab18332, RRID:AB_444424 Anti-GSDMD Abcam Cat#ab219800; RRID:AB_2888940 Anti-VSV Sigma Cat#V4888; RRID:AB_261872 Anti-Flag Sigma Cat#F2555; RRID:AB_796202 Chemicals, peptides, and recombinant proteins Entrectinib TargetMol Cat#T3678 Repotrectinib TargetMol Cat#T4071 Belizatinib TargetMol Cat#T4257 Larotrectinib TargetMol Cat#T5995 Val-boroPro TargetMol Cat#T37861 MSU Sigma Cat#69-93-2 ATP Sigma Cat#34369-07-8 PMA (phorbol-12-myristate-13-acetate) Sigma Cat#P8139 Poly (dA:dT) Sigma Cat#86828-69-5 Protein G agarose Sigma Cat#P7700 Propidium iodide (PI) Sigma Cat#P4170 b-hydroxybutyrate (BHB) Sigma Cat#52017 Pronase Sigma Cat#P5147 Imiquimod MedChemExpress Cat#HY-B0180 Nigericin MedChemExpress Cat#HY-127019 MCC950 MedChemExpress Cat#HY-12815 CY-09 MedChemExpress Cat#HY-103666 Tranilast MedChemExpress Cat#HY-B0195 Tivantinib MedChemExpress Cat#HY-50686 b-Estradiol MedChemExpress Cat#HY-B0141 Alum Thermo Fisher Scientific Cat#77161 Mitotracker Thermo Fisher Scientific Cat#M7512 Pam3CSK4 Invivogen Cat#tlrl-pms LPS Invivogen Cat#tlrl-peklps MitoSOX Invitrogen Cat#M36008 DAPI Invitrogen Cat#D21490 MQAE Invitrogen Cat#162558-52-3 Lipofectamine 2000 Invitrogen Cat#11668019 SiO2 InvivoGen Cat#tlrl-sio-2 (Continued on next page) e1 Cell Reports Medicine 4, 101310, December 19, 2023

    Techniques: Enzyme-linked Immunosorbent Assay, Staining